The study, cleared by the Institutional Ethical Committee, included 115 children <12 years of age after obtaining a written consent from the parents. Ninety children who were healthy without any clinical evidence of the disease were included, of these 45 had a scar at the site of BCG administration, and 45 did not have a scar (henceforth referred to as scar-positive and scar-negative groups, respectively). On interrogating the parents, it was recorded that about 10 children (22%) in the latter group had a definite history of vaccination. In addition 25 children with tuberculosis – confirmed by radiological evidence and sputum smear microscopy for pulmonary tuberculosis (n = 11) and biopsy for extra-pulmonary tuberculosis (lymph node; n= 14), visiting the clinics of 'Mahavir Hospital and Research Center' and 'State Tuberculosis Center, AP' were included in the study. Retrospective analysis of data was done to determine the incidence of tuberculosis in 267 children who attended Mahavir Hospital-DOTS clinic, Hyderabad, India during 1996–2005. The population coverage by the clinic was 100000 initially in 1996 and was scaled up to 500000 by 1998. Informed consents and ethical issues were the major constraints in including a larger number of children and performing the tuberculin skin test, which is an invasive procedure.

Genomic DNA of M. bovis was purified from the cultured cells of M. bovis BCG using standard procedures. Primers VLV85AFOR: 5'- AATCCGCATATGCAGCTTGTTG ACAGGGTTCGTGGC -3' and VLV85AREV: 5'- AACTGTGGATCCCTAGTGGTGGTGGTGGTGGTGGGCTCCCTGGGGCGCGG -3', designed for the ORF sequence for the Mycobacterium bovis gene for 32kDa protein (antigen 85 A) (GenBank: D26486) incorporating a C- terminal His tag. The gene was amplified in GeneAmp PCR System 2700 (ABI) by Acutaq (Sigma) using Genomic DNA as template at different MgCl₂ (2 mM–8 mM) concentrations. The conditions used for the amplification were: Initial denaturation at 95°C for 10 minutes followed by 40 cycles of 95°C for 1 minute, 65°C for 1 minute and 72°C for 1 minute 30 seconds. This was followed by final extension of 15 minutes at 72°C. The PCR product was extracted and digested with NdeI and BamHI (NEB). This was cloned into pET23a (Novagen). The clones were confirmed by restriction digestion and sequencing with T7 promoter primer on an Applied Biosystems Prism 377 DNA sequencer. The clone was expressed in E. coli BL21 (DE3) plysS (Novagen). The transformants were cultured in Terrific broth supplemented with ampicillin (Sigma, Aldrich, St.Louis, MO, USA) & chloramphenicol (Sigma, Aldrich, St.Louis, MO, USA) and was induced at late log phase with 0.7 mM IPTG for 6 hours. The protein was purified under native conditions using Ni-NTA(Qiagen, Valencia, CA, USA) Chromatography, designed for the purification recombinant 6XHis-tagged proteins and was concentrated using 3 KDa Molecular Weight cut off Centriplus concentrators (Millipore, Billerica, MA, USA). Integrity of the protein was checked on 10% SDS PAGE (Fig. 1). The protein concentration was estimated by Bradford's method.

CD3+, CD4+ and CD8+ cell counts were performed using four-color BD FACSCalibur system flow cytometer (BD Biosciences, San Jose, CA, USA). For staining, 50 μl of whole blood was aliquoted into 12 × 75 mm polystyrene BD TruCOUNT™ Tubes (BD MultiTEST™, San Jose, CA, USA) containing 20 μl CD3 FITC/CD8 PE/CD45 Per CP/CD4 APC antibody (BD Pharmingen™, Franklin Lakes, NJ, USA). The samples were mixed well and incubated for 20 minutes at room temperature in the dark and then lysed using 450μl of lysing solution and incubated for 10 minutes. The tubes were centrifuged at 90 g (1000 rpm) for 5 minutes and the supernatant discarded. Two ml of PBS buffer (PH 7.2–7.4, 0.05 M) was added in the tube and it was centrifuged again at 90 g (1000 rpm) for 5 minutes. After the supernatant was discarded and the cells resuspended in 500ul of PBS, the samples were acquired within 2 hrs after staining and anlysed by using CellQuest Pro software (BD Biosciences, San Jose, CA, USA).

For assessing T cell proliferation, blood was drawn in Heparin (5000 I.U/5 ml; Biological E limited, Hyderabad, AP, India), diluted with equal volume of RPMI-1640 medium (Invitrogen corporation, Grand Island, N.Y. USA) without AB serum, layered on Histopaque (Sigma, St Louis, MO, USA) gradient in 1:3 proportion and centrifuged at 200–350 g (1500–2000 rpm) for 30 minutes. After the peripheral blood mononuclear cells (PBMC) were isolated, washed twice to remove the cell debris and platelets each at 90 g (1000 rpm) for 10 minutes, the cell concentration was adjusted to 1 million cells/ml. Viability of the cells was checked using Trypan blue (Sigma Aldrich, St.Louis, MO, USA). To 0.1 ml of cell suspension 0.1 ml of media for the control wells, 8 μl (3 mg/ml) of recombinant protein (r32kda-BCG, also referred to as Ag85A-BCG) in 0.1 ml of media and 30 μl of 1 mg/ml Concanavalin A (Con-A, Sigma Aldrich, St.Louis, MO, USA) for the experimental wells were added in duplicates. Concentration of the recombinant protein was standardized based on the optimal proliferation of the cells using children's blood samples. The plate was incubated at 37°C with 5% CO₂ and humidified air. At the end of the 3^rd day for Con-A and 5^th day for the antigen, MTT (3-(4-5-dimethyl thiazol-2-yl) 2,5, diphenyl tetrazoleum bromide) (Sigma Aldrich, St.Louis, MO, USA) was added and optical density (OD) measured at 570 nm and 620 nm reference filter 323 in ELISA reader (BIO-RAD, Hercules, CA, USA). Stimulation index (SI), a ratio between the OD values of the test and control, was considered as positive if ≥ 2 23.

Sandwich Enzyme Linked Immunosorbent Assay (ELISA) was performed to measure the IFN-γ levels in the supernatants collected from the above cultures. To each well, 50 μl of the capture antibody (BD pharmingen™, Franklin Lakes, NJ, USA). diluted in coating buffer was added and incubated over night at 4°C. After 5 washes, the wells were blocked with 50 μl of 2% BSA for 3 hours at 37°C. A further 5 washes were followed by the addition of 50 μl of supernatants and standards and then incubated for 4 hours at room temperature. After another 5 washes, 50 μl secondary antibody was added, incubated for 3 hours at 37°C and washed 5 times. After addition of 50 μl of working detector (HRP antigen, BD pharmingen™, Franklin Lakes, NJ, USA) and incubation for one and half hour and 5 washes, the wells were incubated with the substrate (50 μl) Ortho Phenyl Diamine (OPD, Sigma, St. Louis, MO, USA) + H₂O₂ (Qualigen, Mumbai, MH, India) for 20 minutes at room temperature in the dark. 50 μl of stop solution was added and absorbance was measured at 490 nm.

Student's-t test was used for comparing the mean values between the groups. Chi-square test to compare number of children between the groups was done by cross tabulation method. A p value of ≤ 0.05 was considered as significant.

The protein was purified under native conditions using Ni-NTA Chromatography. The purified r32KDa protein was separated on an 10% gel and visualized for expected protein band using Coomassie Brilliant Blue. The purity of the protein was about 95%. To remove the endotoxin contamination, purified recombinant 32KDa protein was incubated with 10% v/v polymyxin B-agarose (Sigma-Aldrich; binding capacity, 200 to 500 μg of LPS from Escherichia coli serotype O128:B12/ml) for 1 hour at 4°C. For further immunological studies this endotoxin free r32KDa protein was used.

The mean (±SD) numbers of CD3+, CD4+, CD8+ cells and the SIs in T cell proliferation assay against Con-A, were comparable in all the three groups of children (values not shown in the tables).

When the 267 children with TB (tuberculosis)were classified into different age-groups, the highest number (n = 116) was observed in age group 13–14 years followed by children in the age group 9–12 years (n = 96). The numbers declined further with the last group (age < 6 years) having the least number (n = 20). Chi-Square between the number of children in different age groups was highly significant (242.22; p < 0.000).

Stimulation Indices and their IFN-γ levels in the supernatants in PBMC assay according to their age distribution in vaccinated children were shown in Figure 2. Significant differences were observed between the SI in <6 years (5.60 ± 2.8) and that in 9–12 years groups (2.70 ± 1.13) (p < 0.0002); between 6–8 years (4.36 ± 2.1) and 9–12 years (2.70 ± 1.13) groups (p < 0.013). Significant differences were observed between the IFN-γ levels in <6 years (3316 ± 718 pg/ml) and that in 9–12 years groups (1360 ± 344 pg/ml) (p < 0.003); between 6–8 years and 9–12 years groups (2880 ± 733 and 1360 ± 344; p < 0.01).

Percent number and mean ± SD of negative (<2) and positive (≥2) stimulation indices (SI) in PBMC assays with BCGr32Kda protein observed in children (a) with BCG scar (b) without scar and (c) with TB are shown in Table 1. The proliferation in healthy BCG scar positive children were significantly high when compared to that in scar negative- and tuberculosis- children with a p < 0.0004 and 0.0014 respectively. Seventy nine percent of vaccinated children showed positive proliferative responses with a mean SI value of 4.98 ± 1.99 while only 39% of the unvaccinated and 58% of the tuberculosis children showed positive responses with mean values of 2.9 ± 1.6 and 2.9+1.7, respectively. Chi-square test by cross tabulation method to compare number of children between scar positive and scar negative children was: 10.465; p < 0.001 and between scar positive versus tuberculosis, 3.630; p < 0.057.

The overall mean IFN-γ levels (2744 ± 1004pg/ml) in vaccinated children was significantly high (p < 0.0008) when compared to 1556 ± 490 pg/ml in scar-negative and to 2112 ± 988 pg/ml in TB children (Figure 3). 2046 pg/ml of IFN-γ was considered as the cut-off value (based on the least arithmetic mean + standard deviation in scar negative children). 66% of the vaccinated children, 40% of TB children and only 10% of scar negative children showed IFN-γ levels greater than 2046 pg/ml.