Immunostimulatory effects of three classes of CpG oligodeoxynucleotides on PBMC from HCV chronic carriers

1476-8518-6-3 1476-8518 Original research Immunostimulatory effects of three classes of CpG oligodeoxynucleotides on PBMC from HCV chronic carriers Cooper L Curtis ccooper@ottawahospital.on.ca Ahluwalia K Navneet nahluwalia@coleypharma.com Efler M Susan sefler@coleypharma.com Vollmer Jörg jvollmer@coleypharma.com Krieg M Arthur akrieg@coleypharma.com Davis L Heather hdavis@coleypharma.com

Division of Infectious Diseases, University of Ottawa at The Ottawa Hospital and Ottawa Health Research Institute, Ottawa, Canada

Coley Pharmaceutical Canada, Ottawa, Canada

Coley Pharmaceutical GmbH, Langenfeld, Germany

Coley Pharmaceutical Group, Wellesley MA, USA

Journal of Immune Based Therapies and Vaccines 1476-8518 2008 6 1 3 http://www.jibtherapies.com/content/6/1/3 18541039 10.1186/1476-8518-6-3 15 3 2008 09 6 2008 09 6 2008 2008 Cooper et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Chronic hepatitis C virus (HCV) infection results from weak or absent T cell responses. Pegylated-interferon-alpha (IFN-α) and ribavirin, the standard of care for chronic HCV, have numerous immune effects but are not potent T cell activators. A potent immune activator such as TLR9 agonist CpG oligodeoxynucleotide (CpG) may complement current treatment approaches.

Methods

Peripheral blood mononuclear cells (PBMC) obtained from HCV chronic carriers who failed previous treatment and from healthy donors were incubated in vitro with the three main CpG classes (A, B or C), recombinant IFN-α-2b (IntronA) and/or ribavirin. Proliferation and cytokine secretion (IFN-α, IL-10 and IP-10) were evaluated.

Results

CpG induced proliferation and cytokine secretion in patterns expected for each CpG class with similar group means for HCV and healthy donors. IntronA and ribavirin, alone or together, had no detectable effects. IntronA and C-Class CpG together induced more IFN-α than CpG alone in most subjects. IFN-α secretion was proportional to the number of plasmacytoid dendritic cells in PBMC from healthy donors but not HCV donors in whom responses were highly heterogeneous.

Conclusion

The strong immune stimulatory effect of CpG on PBMC isolated from treatment-failed HCV patients suggests possible utility alone or in combination with current HCV antiviral treatment.

Background

Hepatitis C virus (HCV)-induced liver disease is an important health issue 12. Acute infection usually is not spontaneously cleared in part due to immune escape by emerging quasispecies 3 and virus-induced immune dysfunction. HCV-specific Th1-type immune responses, which are considered essential for longterm viral control and eradication 45 are stronger and broader in those with self-resolving acute infection in comparison to those who go on to develop chronic disease 6789. These responses improve during therapy but remain much weaker than with self-resolving infection 101112. This suggests that the relatively poor response (< 50% for genotype 1) achieved with pegylated-interferon-alpha (PEG-IFN-α) and ribavirin13 may be due to inadequate immune stimulation. PEG-IFN-α and ribavirin both appear to possess anti-viral and some immune modulatory activities 1415. Although the mechanism of ribavirin activity remains unresolved this medication may enhance virological and biochemical responses that are associated with faster second phase viral decay with consequent accelerated reduction in the pool of infected cells 16171819. Ribavirin activity may be mediated by reduced T cell production of IL-10 202122. IL-10 has been proposed to promote the formation of regulatory T cells (Treg) in chronic HCV that inhibit the generation of desirable Th1 type T cell responses 23. However, neither PEG-IFN-α nor ribavirin appear to be a potent immune stimulators 2425. As such, HCV treatments may benefit from more potent immune modulators used alone or in combination with current treatment regimes.

Toll-like receptors (TLR) expressed by immune cells recognize specific pathogen-associated patterns, and play a critical role in regulating innate and adaptive immunity 2627. Synthetic oligodeoxynucleotides (ODN) containing immunostimulatory CpG motifs (CpG) directly activate human B cells and plasmacytoid dendritic cells (pDC) through TLR9 28. Other immune cells are indirectly activated. CpG has potential utility in HCV via multiple mechanisms of viral control. These include activation of natural killer (NK) cells which clear virus from infected hepatocytes during acute infection 293031, pDC maturation for improved antigen presentation, and enhanced Th1 cytokine profiles (IL-12, IFN-γ and many IFN-α subtypes) that have known antiviral properties and promote Th1-biased lytic and non-lytic T cell responses 32. This former property is observed even in the presence of pre-existing Th2 responses 33.

CpG properties vary depending on length, sequence, backbone and formation of secondary or tertiary structures. Three main classes of stimulatory CpG are described 34. A-Class CpG is synthesized with a chimeric backbone with nuclease resistant phosphorothioate 5' and 3' ends and a native phosphodiester central CpG motif region. These molecules form higher ordered structures and are characterized by strong NK cell and pDC activation, high levels of IFN-α production, and limited B cell activation 35363738. B-Class CpG are phosphorothioate throughout and do not form secondary structures. They are characterized by strong B cell activation 39, moderate NK activation 29, and pDC activation with moderate IL-12 and limited IFN-α production. C-Class CpG are phosphorothioate molecules with a 3' palindrome region that permits stem-loops and duplexes. They have properties intermediate to A- and B-Classes with good B cells and NK cells activation, and induce DC IFN-α secretion 384041. The higher order structures of A- and C-Classes appear to affect intracellular localization and facilitate cross-linking of TLR9 receptors, which may be associated with IFN-α induction.

A B-Class CpG has entered clinical testing and has demonstrated efficacy together with doublet chemotherapy in a Phase II study in non-small cell lung cancer [manuscript submitted] and as a hepatitis B vaccine adjuvant 42 in healthy volunteers 4344 and vaccine hyporesponsive HIV-infected patients 45. Based on this knowledge, we evaluate the ability of different CpG classes to stimulate immune cells from healthy or HCV-infected donors to proliferate and secrete key cytokines.

Methods

Human PBMC

Peripheral blood mononuclear cells (PBMC) were recovered from 27 adult volunteers (12 healthy, 15 HCV treatment refractory) at The Ottawa Hospital, Ottawa, Canada under informed consent and IRB approval. Subjects with other chronic infections or who had received HCV therapy within 3 months were excluded. Viral genotypes for the 15 HCV-infected subjects was: 1b (n = 6), 1a (n = 5), 3a (n = 3) and 4c (n = 1). PBMC were purified from whole blood (200 ml, venous puncture, heparinized vacutainers) by centrifugation over Ficoll-Pacque (Amersham Pharmacia Biotech, Uppsala, Sweden) at 400 × g for 35 min. Cells were resuspended in RPMI complete media containing 10% normal human AB serum (heat inactivated) and 1% penicillin/streptomycin at 10 × 10⁶/ml and used fresh to assay cytokine secretion and proliferation.

Reagents

ODN sequences were: A-Class CpG (2336; GGG*G*A*C*G*A*C*G*T*C*G*T*C*GGGGGG), B-Class CpG (2006; TCGTCGTTTTGTCGTTTTGTCGTT), C-Class CpG (2429; TCGTCGTTTTCGGCGGCCGCCG) and non-CpG control (4010 ; TGCTGCTTTTTGCTGGCTTTTT). B- and C-Class CpG had entire nuclease resistant phosphorothioate backbones. A-Class CpG had chimeric backbone with central phosphodiester region (indicated by *) and phosphorothioate ends. All ODN, verified to be endotoxin-free (Coley Pharmaceutical GmbH; Langenfeld, Germany), were resuspended in TE buffer at pH 8.0 (OmniPur^®; EM Science, Gibbstown, USA) and diluted in RPMI 1640 complete media (GibcoBRL, Grand Island, USA) containing 10% heat inactivated, normal human AB serum (Wisent, St. Bruno, Canada) and 1% penicillin/streptomycin (GibcoBRL) just prior to use in cell assays.

Phytohemagglutinin (Sigma-Aldrich, Oakville, Canada), positive control in cell stimulation assays, was diluted in media then added to cells for final concentration of 10 μg/ml.

IntronA (Schering, Pointe-Claire, Canada) was added to the culture media for final concentrations of 125 or 1000 IU/ml. Ribavirin (CN Biosciences, La Jolla, USA) was reconstituted to 500 μM with sterile distilled water then diluted in media and added to cells for final concentration of 5 μM.

Immune assays

Cytokine Assays

Freshly isolated PBMC (1 × 10⁶in 200 μl complete RPMI media) were incubated at 37°C with 5% CO₂in 96-well flat-bottom plates with ODN at 3 or 6 μg/ml (approximately 0.5 and 1 μM). Cell supernatants collected after 48 hrs were stored at -80°C until assayed. Media alone and PHA were negative and positive controls respectively.

Commercial ELISA kits were used according to manufacturer instructions to measure IP-10, IL-10 (R&D Systems, Minneapolis, USA) and multi-species human-IFN-α (PBL Biomedical Laboratories, Piscataway, USA). The kit specified detection limits were used for ELISA values below these limits (16, 23 and 31 pg/ml for IP-10, IL-10 and IFN-α respectively).

Preliminary dose-response data for CpG on PBMC from 3 healthy donors cultured with C-Class (1, 3, 6, 9 and 12 μg/ml final concentration) and B-Class (1, 3, and 6 μg/ml) CpG showed maximum responses 3 μg/ml for IFN-α and at 6 μg/ml (B-Class) or 12 μg/ml (C-Class) for IP-10 and BCP levels. Due to blood volume limitations, CpG was tested only at 3 and 6 μg/ml for B- and C-Classes (approximately 0.5 and 1 μM respectively) and 6 μg/ml for the A-Class.

PBMC proliferation

ODN solutions (100 μl) were added to 96 well plates to give final concentrations of 3 or 6 μg/ml. Isolated PBMC were resuspended at 1 × 10⁶/ml in complete RPMI media and 100 μl of cells were added to each well and cultured for 5 days at 37°C with 5% CO₂. Cells were pulsed with ³H-thymidine (1 μCi/well) for 18 h then harvested onto filter paper; radioactivity was measured and reported as a stimulation index (SI) relative to untreated media control.

Identification of pDC by flow cytometry

Three-colour immunofluorescent flow cytometric analysis was used to quantify pDC. 3 × 10⁶PBMC were resuspended in 300 μl of complete RPMI media and divided among three tubes, one as negative control (autofluorescence), and two for pDC detection of lineage negative, CD11c negative, HLA-DR positive, and either BDCA-4 positive or CD123 positive. Monoclonal antibodies were: Mouse IgG1 Anti-Human BDCA-4-PE (Miltenyi Biotech, Auburn, USA), Mouse IgG1 Anti-Human CD123-PE (BD Biosciences-Pharmingen, San Diego, USA). Mouse Anti-Human CD11c-PC5 (BeckmanCoulter, Fullerton, USA), Mouse IgG1 Anti-Human HLA-DR-ECD (BeckmanCoulter) and a FITC-conjugated mouse IgG1, IgG2b anti-human lineage cocktail including CD3, CD14, CD16, CD19, CD20, CD56 (BD Biosciences-Pharmingen). Staining was per manufacturer recommendations; analysis by flow cytometry counted 50,000 events per sample (Beckman Coulter Epics XL-MCL, Expo32 software).

Epstein Barr Virus immortalized B-cell lines

Healthy PBMC from 5 donors were resuspended in 2.5 ml of RPMI media (5 × 10⁶cells) containing 10% fetal bovine serum (GibcoBRL) and 1% penicillin/streptomycin. Epstein-Barr virus (EBV)-containing supernatant (2.5 ml) previously collected from a EBV transformed B cell line (B95-8, ATCC, Manassas, USA) per manufacturer instructions was mixed with PBMC and incubated 2 hr at 37°C with 5% CO₂. Cyclosporin A (Sigma-Aldrich) at 1 μg/ml in RPMI complete media was added to a final volume of 10 ml and cells were grown 4 wk in flasks at 37°C with 5% CO₂.

Statistical analysis

Data were expressed as group means ± standard errors of the means (SEM) for absolute data. Student's t test was used to compare two groups and one-factor analysis of variance (ANOVA) followed by the Mann Whitney Test for three groups or more.

Results

Cytokine secretion

Healthy donor PBMC secreted the highest levels of IFN-α and IP-10 (Figure 1). Consistent with a previous report, secretion was greatest with A-Class, less with C-Class, and least with B-Class CpG 38. HCV PBMC yielded results similar to that of healthy PBMC for B- and C-Classes but produced significantly less IFN-α (p = 0.02) and a trend to less IP-10 with A-Class CpG. All CpG classes induced similar IL-10 levels in healthy and HCV PBMC (Figure 1).

Figure 1

Levels of cytokines secreted by PBMC from healthy (n = 9 to 12) or HCV-infected (n = 13 to 15) donors after 48 hr culture with media, recombinant IFN-alpha (rIFN-α, 125 IU/ml), ribavirin (RBV, 5 μM), non-CpG control ODN, A-Class, B-Class or C-Class CpG (all ODN at 6 μg/ml). White bars (Healthy) and black bars (HCV), show mean values and standard error of the means for each group of subjects. The lowest limit of quantification for each of the parameters was as follows: IFN-α, 31.2 pg/ml, IL-10, 23.4 pg/ml and IP-10, 7.8 pg/ml.

Two methods were used to quantify pDC in CD11c negative, HLA-DR positive cells: (i) BDCA-4 detection, which is specific to pDC but may be down-regulated upon pDC activation leading to concerns regarding undercounting, and (ii) CD123 detection, which is also expressed on basophils 46 [N.B. basophils are negative for HLA-DR]. Both methods yielded similar numbers of pDC from healthy (73 ± 42 and 56 ± 27 respectively, mean ± SD of 50,000 events) and HCV-infected (66 ± 30 and 58 ± 23) donors. Linear regression demonstrated a good correlation between number of pDC (BDCA-4 analysis) and amount of IFN-α secreted in response to C-Class CpG for normal donors (R²= 0.76). This was not identified in HCV donors (R²= 0.06) although a better correlation (R²= 0.43) was observed for HCV subjects with low blood levels of HCV RNA (< 600,000 IU/ml) (Figure 2). Similarly, A- and B-Class CpG stimulated IFN-α secretion that was well correlated with the number of pDC in normal (R²= 0.50 or 0.51 respectively) but not HCV (R²= 0.04 or 0.09) PBMC (not shown). The amount of IFN-α produced per pDC varied widely with HCV PBMC and did not correlate with viral RNA blood levels (Figure 3).

Figure 2

Flow cytometric analysis of pDC in freshly isolated PBMC from healthy (open circles, n = 12) and HCV-infected (grey or black triangles, n = 15) donors; HCV donors with low viral load at baseline (< 600,000 IU/ml) are indicated by grey triangles. Numbers of pDC counted among 50,000 events by flow cytometry of lineage negative, CD11c negative, HLA-DR+, BDCA4+ cells are plotted against the amount of IFN-α secreted by 1× 106 cells cultured for 48 hrs in the presence of the C-Class CpG at 6 μg/ml. Each point represents the results for an individual subject (average of duplicate assays).

Figure 3

Correlation of blood levels of HCV RNA and levels of IFN-α secreted per pDC from individual HCV-infected donors (n = 15)

Correlation of blood levels of HCV RNA and levels of IFN-α secreted per pDC from individual HCV-infected donors (n = 15). The amount of IFN-α secreted by 1 × 10⁶cells cultured for 48 hrs with A-Class (black symbols) or C-Class (white symbols) CpG (6 μg/ml) was divided by the number of pDC (lineage negative, CD11c negative, HLA-DR+ and BDCA4+), counted among 50,000 events by flow cytometry and plotted against HCV RNA levels for the same subjects.

PBMC proliferation

Under the culture conditions used, CpG-induced PBMC proliferation is thought to be mostly B cell related 47. As previously reported 38, proliferation of PBMC from healthy donors was weak with A-Class but strong with B- and C-Class CpG. B- and C-Classes had similar effects at high concentration (~1 μM) (Figure 4) but at low concentration (~0.5 μM) the B-Class was more potent (p < 0.03, not shown). The non-CpG control ODN caused some proliferation, which is attributed to the weak TLR9-dependent stimulation of cells by the phosphorothioate backbone 48. This was greater than that seen with the A-Class chimeric backbone (p = 0.0023). There were no significant differences in the proliferative responses between PBMC from healthy and HCV-infected subjects with any of the three classes of CpG (p > 0.05).

Figure 4

Proliferative responses in PBMC from healthy (open circles, n = 10 to 12) or HCV-infected (filled circles, n = 10 to 15) donors after incubation with A-, B- or C-Class CpG (6 μg/ml), positive control PHA (10 μg/ml) or non-CpG control ODN (6 μg/ml) for 5 days, then pulsing with 3H-thymidine for 16 to 18 hours

Effects of IntronA and ribavirin

As expected, IP-10 was induced by IntronA (Figure 1). The amount was similar to that with B-Class but significantly less than with A- or C-Class CpG (p < 0.002). IntronA did not induce proliferative responses (data not shown) or IL-10 secretion (Figure 1).

The IFN-α ELISA assay does not differentiate between exogenous and endogenous forms. To determine whether IntronA induced IFN-α secretion from pDC we used EBV-immortalized B cell lines. These cells have IFN-α receptors but do not produce IFN-α which allows for the amount of IntronA remaining after 48 hr culture to be estimated. Seventeen experiments adding IntronA (125 IU/ml) to five different B-cell lines for 48 hr gave a mean level over media background of 172 ± 81 pg/ml. This was deemed to be a better estimate than measuring IFN-α after spiking media with IntronA (319 ± 112 pg/ml, n = 13) since metabolic degradation by cultured cells was expected. Amounts of IFN-α in supernatants of HCV or healthy PBMC and B-cell lines cultured with IntronA were similar (p < 0.05) indicating IntronA does not induce significant IFN-α secretion (Figure 5).

Figure 5

Levels of IFN-α secreted by PBMC from healthy (n = 9 to 12) or HCV-infected (n = 13 to 15) donors after 48 hr culture with recombinant IFN-α (rIFN-α, 125 IU/ml), ribavirin (RBV, 5 μM), rIFN-α plus ribavirin, C-Class CpG (6 μg/ml) or CpG plus rIFN-α. Horizontal black bars show group mean values, and numbers of subjects (n) in each group are indicated below the X-axis. The background level of IFN-α deemed to be contributed by the added rIFN-α alone, as measured in control B-cell line experiments (334 pg/ml), is shown by the hatched line.

Ribavirin alone or in combination with IntronA did not induce significant IFN-α secretion (Figure 5). Ribavirin alone also failed to induce IP-10 or IL-10 secretion (Figure 1).

IntronA combined with CpG

IntronA combined with C-Class CpG significantly augmented the amount of IFN-α secreted relative to CpG alone (p < 0.02) (Figure 5). Individual data revealed a greater than 50% increase over CpG alone for all donors tested.

All (12/12) healthy and most (13/15) HCV donors achieved a minimum 50% increase and 4/12 and 3/15 produced a minimum 100% increase in IFN-α secretion over CpG alone with addition of Intron A (Figure 6). Synergy did not correlate with HCV genotype or viral RNA level (R²< 0.2) (Figure 7); both of these viral characteristics influence therapeutic response 184950.

Figure 6

Percent change in amount of IFN-α secreted by PBMC after 48 hr culture with rIFN-α (125 IU/ml) plus C-Class CpG (6 μg/ml) over that with CpG alone

Percent change in amount of IFN-α secreted by PBMC after 48 hr culture with rIFN-α (125 IU/ml) plus C-Class CpG (6 μg/ml) over that with CpG alone. The amount of IFN-α measured for rIFN-α alone for each subject was subtracted from the rIFN-α plus CpG value to account for rIFN-α itself remaining in the culture media. Individual data is shown for PBMC from healthy (open bars, n = 12) or HCV-infected (closed bars, n = 15) donors.

Figure 7

Correlation of blood levels of HCV RNA and levels of IFN-α secreted by PBMC from individual HCV-infected donors (n = 15) after 48 hr culture with A-Class (black symbols) or C-Class (white symbols) CpG (6 μg/ml). The 7 HCV subjects with low viral load (< 600,000 IU/ml) had R2 values of 0.07 and 0.005 for the A- and C-Class CpG respectively.

No augmentation was seen for CpG-induced IP-10 or IL-10 or PBMC proliferation (data not shown). It is possible that CpG alone induced maximal IP-10 and hence no additive effects were noted despite higher levels of IFN-α. A similar phenomenon with IFN-α and IP-10 induction by B-Class CpG has been described 51.

Discussion

Recognition of the need to overcome immune dysfunction in chronic HCV and induce strong virus-specific T cell responses has led to the evaluation of immune modulators alone and in combination with current HCV therapies. We demonstrated CpG-induced PBMC stimulation in both healthy and HCV-infected donors. Of note, high level IFN-α secretion by pDC was produced following A- and C-Class CpG induction 32,

A-Class CpG induce very high amounts of IFN-α secretion from pDC 3752. We found diminished IFN-α levels with chronic HCV compared to healthy donor PBMC. This is consistent with a number of earlier studies of A-Class CpG on PBMC 535455 or purified pDC 56. One study with purified pDC study failed to reveal a difference 57. In the present study, lower IFN-α secretion in those with HCV cannot be explained by reduced pDC numbers since IFN-α levels and pDC numbers did not correlate. One previous study identified similar levels of IFN-α in healthy and HCV pDC 54. Reduced IFN-α secretion was attributed to reduced numbers of circulating pDC. In another study, levels of IFN-α per pDC were lower with HCV 55. A greater than one hundred-fold reduced capacity in IFN-α production was attributed to immature phenotype and compartmentalization of pDC in the inflamed liver 55. It is note worthy that in our evaluation PBMC stimulation with B- or C-Class CpG produced no differences in proliferation and cytokine secretion between health volunteers and HCV-infected study participants.

Structural differences between A- and C-Class CpG may account for variable IFN-α secretion outcomes. Monomeric molecules such as B-Class CpG can activate TLR9 but only the A- and C-Classes that form higher ordered structures can induce high levels of IFN-α secretion from pDC. This may be a consequence of cross-linkage with TLR9 receptors 38. A-Class CpGs form large polymeric structures due to their poly-G regions whereas C-Class only form dimers. It has been proposed that pDC revert to a more immature state with chronic HCV infection 55 or that direct HCV infection of pDC may alter their ability to take up and/or respond to the larger A-Class structures 58.

HCV chronic carriers have dysfunctional pDC with impaired capacity to stimulate allogeneic T cells. This may be mediated by altered MHC expression and cytokine production that facilitate regulatory T cells development 56596061. Reduced IFN-α secretion has been noted in response to a non-specific stimulus such as the herpes simplex virus 6 and poly(I:C), a TLR3 ligand 53. As such, the ability of both A- and C-Class CpG to induce IFN-α secretion in PBMC from HCV chronic carriers is notable. IFN-α secretion with C-Class CpG stimulation were similar between healthy donors and HCV infected participants but levels were more variable in the latter group. As a consequence, there was good correlation between the amount of IFN-α secreted and number of pDC in the sample for healthy PBMC but not in the HCV population.

A- and C-Class CpG produced similar levels and types of immune activation with the exception of B-cell proliferation which is more robust following C-Class stimulation. Both were more potent than B-Class. Based on these results, and earlier findings of stronger TLR9-dependent NFkB signaling with C-Class 38, a C-Class CpG (CPG 10101) was chosen for clinical testing in HCV in combination with PEG-IFN-α and/or ribavirin. Thus, our evaluation of the interactions between these medications and CpG in HCV-infected donor PBMC stimulation tests is relevant. As observed in other studies 25, IntronA and/or ribavirin had limited effect on the immune parameters tested. This suggests that these medications may be suboptimal for inducing T cell responses thought to prevent virological relapse following HCV antiviral therapy. Combining IntronA with C-Class CpG augmented IFN-α secretion from pDC. This is consistent with other work suggesting that pre-treatment of human PBMC with recombinant IFN-α primes pDC to respond to the stimulatory effects of bacterial DNA 62. Even thought no ribavirin-CpG synergy was detected in the present in vitro study, such synergy might be realized in vivo. In vivo evaluation has demonstrated that ribavirin may diminish Th2 cytokines including IL-10 thereby enhancing Th1 responses 21 and reducing regulatory T cell induction 63. Blocking the IL-10 receptor on HCV PBMC results in increased HCV-specific IFN-γ producing T cells 23. Hence, ribavirin might enhance in vivo responses to CpG by perturbing IL-10 activity.

Conclusion

In summary, the C-Class of CpG molecules possess effective immunostimulatory effects on PBMC from chronic HCV donors and might provide complementary and additional mechanisms of action to current HCV therapies.

Authors' contributions

CC participated in study design, was responsible for study recruitment and manuscript preparation, NA, SE and JV conducted the analysis and contributed to the manuscript preparation, AK and HD conceived of the study, participated in study design and manuscript preparation. All authors have read and approved the final manuscript.

Acknowledgements

We are grateful to Isabelle Sequin and Diane Cote, clinical study nurses at The Ottawa Hospital, and Sonja McAuley, Clinical Research Associate at Coley Pharmaceutical Group for their assistance in obtaining phlebotomy samples and Kathleen Myette for technical assistance in performing the assays.

Chronic hepatitis C virus management: 2000-2005 update Hughes CA Shafran SD Ann Pharmacother 2006 40 74 82 16368925 Chronic hepatitis C: an age wave of disease burden McHutchison JG Bacon BR Am J Manag Care 2005 11 S286 95; quiz S307-11 16232012 Genetic heterogeneity of hepatitis C virus. The clinical significance of genotypes and quasispecies behavior Marrone A Sallie R Clin Lab Med 1996 16 429 449 8792081 Immunopathogenesis of hepatitis C virus infection: multifaceted strategies subverting innate and adaptive immunity Kanto T Hayashi N Intern Med 2006 45 183 191 10.2169/internalmedicine.45.1530 16543687 A target on the move: innate and adaptive immune escape strategies of hepatitis C virus Thimme R Lohmann V Weber F Antiviral Res 2006 69 129 141 10.1016/j.antiviral.2005.12.001 16413618 Impaired allostimulatory function of dendritic cells in chronic hepatitis C infection Bain C Fatmi A Zoulim F Zarski JP Trepo C Inchauspe G Gastroenterology 2001 120 512 524 10.1053/gast.2001.21212 11159892 Liver-derived CTL in hepatitis C virus infection: breadth and specificity of responses in a cohort of persons with chronic infection Wong DK Dudley DD Afdhal NH Dienstag J Rice CM Wang L Houghton M Walker BD Koziel MJ J Immunol 1998 160 1479 1488 9570570 T-lymphocyte response to hepatitis C virus in different clinical courses of infection Botarelli P Brunetto MR Minutello MA Calvo P Unutmaz D Weiner AJ Choo QL Shuster JR Kuo G Bonino F Gastroenterology 1993 104 580 587 8425701 The role of immune responses in the pathogenesis of hepatitis C virus infection Koziel MJ J Viral Hepat 1997 4 Suppl 2 31 41 10.1111/j.1365-2893.1997.tb00178.x 9429208 Intrahepatic hepatitis C virus-specific cytotoxic T lymphocyte activity and response to interferon alfa therapy in chronic hepatitis C Nelson DR Marousis CG Ohno T Davis GL Lau JY Hepatology 1998 28 225 230 10.1002/hep.510280129 9657116 Peginterferon alone or with ribavirin enhances HCV-specific CD4 T-helper 1 responses in patients with chronic hepatitis C Kamal SM Fehr J Roesler B Peters T Rasenack JW Gastroenterology 2002 123 1070 1083 10.1053/gast.2002.36045 12360469 Hepatitis C virus-specific T-cell reactivity during interferon and ribavirin treatment in chronic hepatitis C Cramp ME Rossol S Chokshi S Carucci P Williams R Naoumov NV Gastroenterology 2000 118 346 355 10.1016/S0016-5085(00)70217-4 10648463 Therapy of hepatitis C: from empiricism to eradication Pawlotsky JM Hepatology 2006 43 S207 20 10.1002/hep.21064 16447262 Type I interferons (alpha/beta) in immunity and autoimmunity Theofilopoulos AN Baccala R Beutler B Kono DH Annu Rev Immunol 2005 23 307 336 10.1146/annurev.immunol.23.021704.115843 15771573 The metabolism, pharmacokinetics and mechanisms of antiviral activity of ribavirin against hepatitis C virus Dixit NM Perelson AS Cell Mol Life Sci 2006 63 832 842 10.1007/s00018-005-5455-y 16501888 Treating HCV with ribavirin analogues and ribavirin-like molecules Gish RG J Antimicrob Chemother 2006 57 8 13 10.1093/jac/dki405 16293677 Relationship between early HCV kinetics and T-cell reactivity in chronic hepatitis C genotype 1 during peginterferon and ribavirin therapy Tang KH Herrmann E Cooksley H Tatman N Chokshi S Williams R Zeuzem S Naoumov NV J Hepatol 2005 43 776 782 10.1016/j.jhep.2005.05.024 16139918 Interferon-alpha-2b plus ribavirin: a review of its use in the management of chronic hepatitis C Scott LJ Perry CM Drugs 2002 62 507 556 10.2165/00003495-200262030-00009 11827565 Effect of ribavirin on hepatitis C viral kinetics in patients treated with pegylated interferon Herrmann E Lee JH Marinos G Modi M Zeuzem S Hepatology 2003 37 1351 1358 10.1053/jhep.2003.50218 12774014 Impact of alpha interferon and ribavirin on the function of maturing dendritic cells Barnes E Salio M Cerundolo V Medlin J Murphy S Dusheiko G Klenerman P Antimicrob Agents Chemother 2004 48 3382 3389 514729 15328100 10.1128/AAC.48.9.3382-3389.2004 Effects of the ribavirin-interferon alpha combination on cultured peripheral blood mononuclear cells from chronic hepatitis C patients Martin J Navas S Quiroga JA Pardo M Carreno V Cytokine 1998 10 635 644 10.1006/cyto.1997.0333 9722937 Ribavirin polarizes human T cell responses towards a Type 1 cytokine profile Tam RC Pai B Bard J Lim C Averett DR Phan UT Milovanovic T J Hepatol 1999 30 376 382 10.1016/S0168-8278(99)80093-2 10190717 Direct evidence for immunomodulatory properties of ribavirin on T-cell reactivity to hepatitis C virus Rigopoulou EI Abbott WG Williams R Naoumov NV Antiviral Res 2007 75 36 42 10.1016/j.antiviral.2006.11.008 17210188 Mechanism of action of interferon and ribavirin in treatment of hepatitis C Feld JJ Hoofnagle JH Nature 2005 436 967 972 10.1038/nature04082 16107837 Immunopharmacology of CpG oligodeoxynucleotides and ribavirin Vollmer J Rankin R Hartmann H Jurk M Samulowitz U Wader T Janosch A Schetter C Krieg AM Antimicrob Agents Chemother 2004 48 2314 2317 415599 15155243 10.1128/AAC.48.6.2314-2317.2004 TLRs, NLRs and RLRs: a trinity of pathogen sensors that co-operate in innate immunity Creagh EM O'Neill LA Trends Immunol 2006 27 352 357 10.1016/j.it.2006.06.003 16807108 Toll-like receptor control of the adaptive immune responses Iwasaki A Medzhitov R Nat Immunol 2004 5 987 995 10.1038/ni1112 15454922 Therapeutic potential of Toll-like receptor 9 activation Krieg AM Nat Rev Drug Discov 2006 5 471 484 10.1038/nrd2059 16763660 Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA Ballas ZK Rasmussen WL Krieg AM J Immunol 1996 157 1840 1845 8757300 Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo Hartmann G Weeratna RD Ballas ZK Payette P Blackwell S Suparto I Rasmussen WL Waldschmidt M Sajuthi D Purcell RH Davis HL Krieg AM J Immunol 2000 164 1617 1624 10640783 Comparison of different CpG oligodeoxynucleotide classes for their capability to stimulate human NK cells Sivori S Carlomagno S Moretta L Moretta A Eur J Immunol 2006 36 961 967 10.1002/eji.200535781 16525994 The nature of the principal type 1 interferon-producing cells in human blood Siegal FP Kadowaki N Shodell M Fitzgerald-Bocarsly PA Shah K Ho S Antonenko S Liu YJ Science 1999 284 1835 1837 10.1126/science.284.5421.1835 10364556 Perspectives in asthma: molecular use of microbial products in asthma prevention and treatment Racila DM Kline JN J Allergy Clin Immunol 2005 116 1202 1205 10.1016/j.jaci.2005.08.050 16337446 TLR9 in health and disease Vollmer J Int Rev Immunol 2006 25 155 181 10.1080/08830180600743107 16818370 Type I interferon dependence of plasmacytoid dendritic cell activation and migration Asselin-Paturel C Brizard G Chemin K Boonstra A O'Garra A Vicari A Trinchieri G J Exp Med 2005 201 1157 1167 2213121 15795237 10.1084/jem.20041930 Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide Gursel M Verthelyi D Gursel I Ishii KJ Klinman DM J Leukoc Biol 2002 71 813 820 11994506 Identification of CpG oligonucleotide sequences with high induction of IFN-alpha/beta in plasmacytoid dendritic cells Krug A Rothenfusser S Hornung V Jahrsdorfer B Blackwell S Ballas ZK Endres S Krieg AM Hartmann G Eur J Immunol 2001 31 2154 2163 10.1002/1521-4141(200107)31:7<2154::AID-IMMU2154>3.0.CO;2-U 11449369 Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities Vollmer J Weeratna R Payette P Jurk M Schetter C Laucht M Wader T Tluk S Liu M Davis HL Krieg AM Eur J Immunol 2004 34 251 262 10.1002/eji.200324032 14971051 A role for Toll-like receptors in acquired immunity: up-regulation of TLR9 by BCR triggering in naive B cells and constitutive expression in memory B cells Bernasconi NL Onai N Lanzavecchia A Blood 2003 101 4500 4504 10.1182/blood-2002-11-3569 12560217 Rational design of new CpG oligonucleotides that combine B cell activation with high IFN-alpha induction in plasmacytoid dendritic cells Hartmann G Battiany J Poeck H Wagner M Kerkmann M Lubenow N Rothenfusser S Endres S Eur J Immunol 2003 33 1633 1641 10.1002/eji.200323813 12778481 Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions Marshall JD Fearon K Abbate C Subramanian S Yee P Gregorio J Coffman RL Van Nest G J Leukoc Biol 2003 73 781 792 10.1189/jlb.1202630 12773511 CpG ODN as a TH1 immune enhancer for prophylactic and therapeutic vaccines. Krieg A Davis H In: Hackett CJ, Harn DA, eds Vaccines Adjuvants: Immunological and Clinical Principles Humana Press Inc 2005 87 110 CPG 7909, an immunostimulatory TLR9 agonist oligodeoxynucleotide, as adjuvant to Engerix-B HBV vaccine in healthy adults: a double-blind phase I/II study Cooper CL Davis HL Morris ML Efler SM Adhami MA Krieg AM Cameron DW Heathcote J J Clin Immunol 2004 24 693 701 10.1007/s10875-004-6244-3 15622454 A phase I study of the safety and immunogenicity of recombinant hepatitis B surface antigen co-administered with an immunostimulatory phosphorothioate oligonucleotide adjuvant Halperin SA Van Nest G Smith B Abtahi S Whiley H Eiden JJ Vaccine 2003 21 2461 2467 10.1016/S0264-410X(03)00045-8 12744879 CPG 7909 adjuvant improves hepatitis B virus vaccine seroprotection in antiretroviral-treated HIV-infected adults Cooper CL Davis HL Angel JB Morris ML Elfer SM Seguin I Krieg AM Cameron DW Aids 2005 19 1473 1479 10.1097/01.aids.0000183514.37513.d2 16135900 BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood Dzionek A Fuchs A Schmidt P Cremer S Zysk M Miltenyi S Buck DW Schmitz J J Immunol 2000 165 6037 6046 11086035 CpG DNA rescue of murine B lymphoma cells from anti-IgM-induced growth arrest and programmed cell death is associated with increased expression of c-myc and bcl-xL Yi AK Hornbeck P Lafrenz DE Krieg AM J Immunol 1996 157 4918 4925 8943396 Oligodeoxynucleotides lacking CpG dinucleotides mediate Toll-like receptor 9 dependent T helper type 2 biased immune stimulation Vollmer J Weeratna RD Jurk M Samulowitz U McCluskie MJ Payette P Davis HL Schetter C Krieg AM Immunology 2004 113 212 223 1782571 15379982 10.1111/j.1365-2567.2004.01962.x Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection Fried MW Shiffman ML Reddy KR Smith C Marinos G Goncales FL Jr. Haussinger D Diago M Carosi G Dhumeaux D Craxi A Lin A Hoffman J Yu J N Engl J Med 2002 347 975 982 10.1056/NEJMoa020047 12324553 Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial Manns MP McHutchison JG Gordon SC Rustgi VK Shiffman M Reindollar R Goodman ZD Koury K Ling M Albrecht JK Lancet 2001 358 958 965 10.1016/S0140-6736(01)06102-5 11583749 CpG oligodeoxynucleotides stimulate IFN-gamma-inducible protein-10 production in human B cells Vollmer J Jurk M Samulowitz U Lipford G Forsbach A Wullner M Tluk S Hartmann H Kritzler A Muller C Schetter C Krieg AM J Endotoxin Res 2004 10 431 438 15588427 Human peripheral blood cells differentially recognize and respond to two distinct CPG motifs Verthelyi D Ishii KJ Gursel M Takeshita F Klinman DM J Immunol 2001 166 2372 2377 11160295 Selective impairments in dendritic cell-associated function distinguish hepatitis C virus and HIV infection Anthony DD Yonkers NL Post AB Asaad R Heinzel FP Lederman MM Lehmann PV Valdez H J Immunol 2004 172 4907 4916 15067070 Normal functional capacity in circulating myeloid and plasmacytoid dendritic cells in patients with chronic hepatitis C Longman RS Talal AH Jacobson IM Rice CM Albert ML J Infect Dis 2005 192 497 503 10.1086/431523 15995965 Plasmacytoid dendritic cells in acute and chronic hepatitis C virus infection Ulsenheimer A Gerlach JT Jung MC Gruener N Wachtler M Backmund M Santantonio T Schraut W Heeg MH Schirren CA Zachoval R Pape GR Diepolder HM Hepatology 2005 41 643 651 10.1002/hep.20592 15726647 Reduced numbers and impaired ability of myeloid and plasmacytoid dendritic cells to polarize T helper cells in chronic hepatitis C virus infection Kanto T Inoue M Miyatake H Sato A Sakakibara M Yakushijin T Oki C Itose I Hiramatsu N Takehara T Kasahara A Hayashi N J Infect Dis 2004 190 1919 1926 10.1086/425425 15529255 Comparable functions of plasmacytoid and monocyte-derived dendritic cells in chronic hepatitis C patients and healthy donors Piccioli D Tavarini S Nuti S Colombatto P Brunetto M Bonino F Ciccorossi P Zorat F Pozzato G Comar C Abrignani S Wack A J Hepatol 2005 42 61 67 10.1016/j.jhep.2004.09.014 15629508 Evidence of viral replication in circulating dendritic cells during hepatitis C virus infection Goutagny N Fatmi A De Ledinghen V Penin F Couzigou P Inchauspe G Bain C J Infect Dis 2003 187 1951 1958 10.1086/375350 12792872 Decreased interferon-alpha production and impaired T helper 1 polarization by dendritic cells from patients with chronic hepatitis C Murakami H Akbar SM Matsui H Horiike N Onji M Clin Exp Immunol 2004 137 559 565 1809147 15320906 10.1111/j.1365-2249.2004.02550.x Subversion of plasmacytoid and myeloid dendritic cell functions in chronic HCV infection Szabo G Dolganiuc A Immunobiology 2005 210 237 247 10.1016/j.imbio.2005.05.018 16164031 Infection and dysfunction of circulating blood dendritic cells and their subsets in chronic hepatitis C virus infection Tsubouchi E Akbar SM Horiike N Onji M J Gastroenterol 2004 39 754 762 10.1007/s00535-003-1385-3 15338369 Anti-double-stranded DNA antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN-alpha inducer in systemic lupus erythematosus Vallin H Perers A Alm GV Ronnblom L J Immunol 1999 163 6306 6313 10570325 The lifestyle of naturally occurring CD4+ CD25+ Foxp3+ regulatory T cells Shevach EM DiPaolo RA Andersson J Zhao DM Stephens GL Thornton AM Immunol Rev 2006 212 60 73 10.1111/j.0105-2896.2006.00415.x 16903906